Diktatur der Satansbrut – Wake News Radio/TV

Abb.: Collage aus Internetbildern und Wake News

ACHTUNG! Durch Löschung unseres Hauptkanals Wecknachricht bei Googles YouTube werden zur Zeit aktuelle Videos von Wake News vor allem hier hochgeladen. Bitte abonniert uns:

https://www.wakenews.tv

https://www.bitchute.com/channel/wakenewsradiotv/

https://www.youtube.com/user/WakeNewsTV

https://www.youtube.com/user/WakeNewsRadio

jetzt auch bei:

Telegram
https://t.me/wake_news

https://www.brighteon.com/channel/redaktion

Wake News Radio-Sendungen LIVE und aktuelle Archive:
Bitte ab sofort nur noch die neuen Wake News Radio-Stream-Links nutzen: (bitte auf link klicken zum Hören der LIVE-Sendung und der Archive!)

Audio-Player:

 

Oder hier den gewünschten Player und die Streamqualität aussuchen:

Radio

Abb.: Wake News

Neu! Ab sofort ist der CORONA-Schwindel Bandana erhältlich:

Abb.: Wake News

Ab sofort ist das Aktions-T-Shirt CORONA-SCHWINDEL
NEIN! zu MASKENZWANG und DIKTATUR im Laufteufelshop zu erhalten, in braun mit gelber Aufschrift und in gelb mit schwarzer Aufschrift, Dreieckstücher folgen!
https://laufteufel.1a-shops.eu/

Aufzeichnung als Videos:

https://www.wakenews.tv/watch.php?vid=b87e3a65d

https://www.bitchute.com/video/aP4JzwAKYge7/

https://www.brighteon.com/45112177-42f0-4457-964e-bff705a74aba

Abb.: de.m.wikipedia.org/wiki/Datei:Franz_Stassen_Clara_Viebig_Das_schlafende_Heer_Umschlag

Wir wissen es längst, aber werden es die schlafenden Horden irgendwann merken? Vermutlich schon; denn es wird uns ja alle treffen, es betrifft uns ja jetzt schon so deutlich.

Abb.: Collage aus Internetbildern und Wake News

Alle, die jetzt an der Macht sind, sind es nur, weil sie die Brut Satans sind. Nur solche, die ihre eigene Grossmutter verkaufen wollen*, schaffen es an die Macht.
*Redensart für solche, die Geld gierig sind (Schuldgeld = Kontrollinstrument)

Abb.: https://www.stern.de/politik/deutschland/rothschild-bot-kunden-gerhard-schroeders-gute-kontakte-in-moskau-an-7589002.html
https://www.lobbycontrol.de/schwerpunkt/seitenwechsel/
https://newstopaktuell.wordpress.com/2016/06/22/was-ist-lobbyismus-und-wie-funktioniert-dieser/
https://www.tagblatt.ch/schweiz/so-beeinflusst-lobbying-die-schweizer-politik-ld.1097906

Man muss erpressbar sein, man muss den Wunsch haben sich und seine Leben zu opfern um an dieser Macht zu kleben.
Diese Figuren, die Mächtigen der Welt, die bilden die Kohorte der Verdammten; denn sie dienen dem Zwecke des Dunklen – gnadenlos. Büchsen sie aus, wollen sie sich gar gegen das Böse wenden, dann sind sie im Weg und werden abgesetzt, sie werden vernichtet, gar aus dem Weg geräumt.

Abb.: s.u.

Maskenconnection ins Kanzleramt – Ehemann von Kurz-Assistentin Österreichs größter Maskenproduzent

Im Moment geht es ums Ganze. Um die Unterwerfung der Massen, die Vorbereitung zum Ende.

Abb.: Internet

Nur diejenigen, die die Masken tragen, werden willig auch die Tests, die uns vielleicht infizieren und chippen sollen und die Spritzen (Impfungen) akzeptieren, die uns als Menschen verändern, gar abschaffen sollen.

Abb.: Wake News
https://laufteufel.1a-shops.eu/

Nur diejenigen, die sich wehren, die NEIN sagen zu Maskenzwang, Impfzwang und DIKTATUR werden eine Chance haben Mensch zu bleiben.

Abb.: Wake News

Es geht jetzt also ums Überleben der Menschheit. Diejenige Satansbrut, die ihr Menschsein für die Macht opfert, wird am Ende auch nichts gewinnen; denn sie haben bereits oder werden dann ihre Seele verlieren an das Dunkle, an das Böse und sind gnadenlos abhängig von Satans Willen.

Abb.: Internet

Wer es bis heute nicht verstanden hat, welch grosse Dinge jetzt auf uns zukommen, dem wird sein Schicksal wie ein Paukenschlag um die Ohren geschlagen und wird grausam geweckt ohne Möglichkeit darauf vorbereitet zu sein.

Gerade aber die CORONA-Inszenierung wurde uns seit langem angekündigt, hier das Beispiel aus einer Szene aus dem Hollywood-Film: Falling Down

Abb.: Sreenshot aus „Falling Down“ (deutsch: ein ganz normaler Tag) mit dem Schauspieler Michael Douglas

Hier verliert urplötzlich ein Mann seinen 7 1/2 Jahre lang innegehabten Job als kleiner, gehorsamer Angestellter, woraufhin er hin- und hergerissen von der Matrixwelt und dem Erwachen aus der Matrix im Erkennen des Irrsinns der Welt schliesslich Amok läuft.

Abb.: Wake News

Der Weg aus diesem Wahn ist Bewusstsein, nicht mehr dem Materiellen frönen, sondern sich besinnen auf das, was uns Menschen ausmacht, das Füreinander, die Nächstenliebe und das Streben hin zum göttlichen SEIN. Schon der Versuch dahin zählt!

Bitte abonniert unbedingt alle unsere eigenen Kanäle:

https://www.wakenews.tv/
https://www.bitchute.com/channel/wakenewsradiotv/
https://www.brighteon.com/channels/redaktion
https://t.me/s/wake_news

Bis nachher!

Eure Wake News Redaktion

+++

Diese Widerstands-Textilien sind ausschliesslich in dem Kleinunternehmens-Shop von Achim erhältlich. Auch er braucht eure Unterstützung!

Abb.: Wake News
https://laufteufel.1a-shops.eu/

Vielen Dank für euer SEIN und eure Aktivitäten!

Abb.: Wake News

Bitte helft uns diese Kanäle zu stärken; denn über kurz oder lang wird uns Google/YouTube bei sich verbannen. Damit spielt dann YouTube in der Aufklärungs-Szene bald keine Rolle mehr. Wir eruieren auch noch andere Videoplattformen, die wir dann auch nutzen werden. Infos folgen, hier findet ihr alle derzeitig genutzten Medien-Plattformen: http://www.wakenews.net/about/!


Abb.: http://www.wakenews.net/radio/

Angesichts der massiven Zensur ist es daher unabdingbar, dass ihr immer unsere Radio-Sendungen hört, live, sowie die Aufzeichnungen!

Auch lasst euch unbedingt auf unsere Email-Newsletter-Liste setzen, hier anfordern: redaktion@wakenews.net

Vielen lieben Dank für eure Aufmerksamkeit und eure Unterstützung!

In dem Sinne! Wir freuen uns auf eure Beiträge unter radio (at) wakenews.net

Danke für eure Aufmerksamkeit!

+++++

Wer sich auf unsere Emailliste setzen lassen will, bitte hier melden: redaktion@wakenews.net

ACHTUNG! gmx und web.de blockieren unsere Email-Newsletter-Zusendungen!

Hinweis: ab Mai 2020 wird es Detlevs Sendung bis auf Weiteres nur noch Dienstags geben. Martins und Michaels Sendungen laufen wie gewohnt, ebenso die UNITEDWESTART Roundtable Discussions – Radiosendungen.

Abb.: https://www.wakenews.tv/watch.php?vid=d30bb6019

https://www.merkur.de/bayern/coronavirus-bayern-ausbruch-soeder-mamming-pressekonferenz-herrmann-quarantaene-ferien-covid19-zr-90013034.html

Exklusives Interview mit Dr. Stefan Lanka

https://www.anonymousnews.ru/2020/07/28/die-integration-ist-gescheitert/

https://ifurinstitut.wordpress.com/2020/05/03/teil-3-eine-voellig-neue-sicht-auf-corona-covid-19-kann-das-us-militaer-von-elektrosensiblen-lernen/

https://www.netdoktor.de/laborwerte/haemoglobin/

https://de.sputniknews.com/panorama/20200419326926411-coronavirus-wissenschaftler-entdecken-neues-alarmierendes-symptom/

https://www.journals.elsevier.com/hematology-transfusion-and-cell-therapy

https://www.sciencedirect.com/science/article/pii/S2531137920300298

http://www.htct.com.br/en-hemoglobin-value-may-be-decreased-avance-S2531137920300298

https://www.t-online.de/unterhaltung/stars/id_88297724/es-ist-offiziell-tom-hanks-und-rita-wilson-sind-jetzt-griechen.html

https://www.zerohedge.com/political/americas-major-cities-are-being-turned-war-zones-and-its-not-going-end-november

https://astrologieklassisch.wordpress.com/2020/07/27/usa-die-groesseren-staedte-sind-kriegszonen/

https://astrologieklassisch.wordpress.com/2020/07/27/ging-es-bei-doktorarbeit-des-drosten-mit-rechten-dingen-zu-ist-er-berechtigt-sich-dr-zu-nennen/

https://astrologieklassisch.wordpress.com/2020/07/28/bill-gates-sagt-in-cbs-dass-er-auf-die-gewaltigen-nebenwirkungen-des-corona-impfstoffs-scheisst/

https://www.epochtimes.de/wirtschaft/finanz/sparkasse-niedrigzinsen-reissen-280-millionen-loch-in-bilanz-der-pensionskasse-rettungspaket-noetig-a3300538.html

https://www.20min.ch/video/drei-schluchten-staudamm-in-china-beschaedigt-972850974173

https://www.mmnews.de/politik/148338-sz-redakteuer-packt-aus

https://www.epochtimes.de/politik/deutschland/aerzte-und-kliniken-meldeten-fuer-410000-beschaeftigte-kurzarbeit-an-a3300267.html

Friedliche Demonstranten und Schießereien: Systematische Desinformation vom ZDF

So lügen die Mainstream-Medien: „Friedliche Demonstranten“ in den USA sind größtenteils KRIMINELLE & ANTIFA-TERRORISTEN! – VIDEOS die Sie NICHT sehen sollen!

Mit falschem Trauschein legal in die EU: Schlepper in Zypern aufgeflogen

https://www.msn.com/de-de/nachrichten/politik/saisonarbeiter-deutschland-nie-wieder/ar-BB17gvGM?ocid=msedgntp

Wem gehört die Zukunft? Angst vor der Apokalypse? Befreiungs-Impuls Nr.62
https://www.befreiungspsychologie.info/2017/12/30/wem-geh%C3%B6rt-die-zukunft-angst-vor-der-apokalypse-befreiungs-impuls-nr-62/

NASA: hebräisch = täuschen !
https://haunebu7.wordpress.com/2020/07/24/nasa-hebraisch-tauschen/

ER*H*EBT EU*CH – 1. VIII .2O2O i*n B*er*lin*
https://www.youtube.com/watch?time_continue=1&v=Kg6oPPgXjFY&feature=emb_logo

Operation Legend: Verhaftungswelle in den USA
https://www.youtube.com/watch?time_continue=2&v=LGe5g4h7QT8&feature=emb_logo

MARKmobil Aktuell – Journalisten leben gefährlich
https://www.youtube.com/watch?v=dOHKaVEdgwc&feature=emb_logo

Gute Nachrichten !!!
https://haunebu7.wordpress.com/2020/07/24/gute-nachrichten/

Ehem. Leiter des FBI Ted Gunderson: „FBI und CIA von NWO und satanischer Bewegung unterwandert“
https://www.youtube.com/watch?v=6CR1nBkkIt8&feature=emb_logo

Fremdbestimmt: „Hinter der Politik entscheiden andere Kräfte“
https://www.youtube.com/watch?v=-kVWwedMsXc&feature=emb_logo

💫Freiheitsstatue von einem Blitzschlag getroffen. 22.07.2020 New York City 🇺🇸
https://www.youtube.com/watch?v=nlxIWT8Hl7w&feature=youtu.be

Henry Kissinger: „Nach Corona muss eine neue Weltordnung etabliert werden“
https://tagesereignis.de/2020/04/politik/henry-kissinger-nach-corona-muss-eine-neue-weltordnung-etabliert-werden/15184/

Die Sonne geht nicht unter, sie entfernt sich !
https://haunebu7.wordpress.com/2020/07/25/die-sonne-geht-nicht-unter-sie-entfernt-sich/

Der Shutdown war der größte Rechtsskandal der BRD | Beate Bahner Rede in Mannheim

https://www.youtube.com/watch?v=ldPIr2Sxo1o&feature=emb_logo

Warum die Indianer ihr Haar lang tragen. Haare als Antennen der Seele
https://www.youtube.com/watch?v=fQO7CvA1hpA&feature=emb_logo

Serbische Soldaten verweigern Befehl, gegen die eigene Bevölkerung vorzugehen
https://derwaechter.org/serbische-soldaten-verweigern-befehl-gegen-die-eigene-bevolkerung-vorzugehen

Unternehmen Capricorn Full Movie – German
https://www.youtube.com/watch?time_continue=3&v=aG-8Tx3moQk&feature=emb_logo

Pelosi kündigt Plan an Trump zu entfernen und selbst zur Präsidentin mit COG Kriegsrecht zu werden!
https://www.youtube.com/watch?v=9uANsHxHayw&feature=emb_logo

Hagia Sophia: Wir sollten Muslime endlich so behandeln, wie sie mit Christen umgehen!
https://philosophia-perennis.com/2020/07/25/hagia-sophia-wir-sollten-muslime-so-behandeln-wie-sie-uns/

Immer mehr Ärzte behaupten: Es gibt die zweite Welle nicht!
https://www.youtube.com/watch?v=yzMfp8yJ05s&feature=emb_logo

Bill Gates: CORONA-IMPFSTOFF ist die „dringendste Erfindung der Welt“
https://www.youtube.com/watch?v=83trDy6WfmY&feature=emb_logo

Der neue C0r0na Sklavenpass? Demnächst auch für Dich!
https://www.youtube.com/watch?v=__yVduZtK9k&feature=emb_logo

Agenda 21 1992
https://www.wakenews.tv/watch.php?vid=83616e1b9
https://www.wakenews.tv/watch.php?vid=65ee7f4ca

Wenn die Wahrheit über Adrenochrom herauskommt, geht Hollywood zugrunde (Video
https://www.pravda-tv.com/2020/07/wenn-die-wahrheit-ueber-adrenochrom-herauskommt-geht-hollywood-zugrunde-video/

**********************

Weitere Links:

https://mywakenews.wordpress.com/2020/07/28/kein-krieg-zwischen-nationen-sondern-ein-krieg-der-cabale-herodianer-tyrannen-gegen-den-freien-selbstbestimmten-menschen-wahr-da-was-wake-news-radio-tv/

https://mywakenews.wordpress.com/2020/07/21/unser-leben-in-tyrannei-team-talk-21-07-2020-wake-news-radio-tv/

https://mywakenews.wordpress.com/2020/07/14/der-plan-der-wenigen-ist-klar-oder-wake-news-radio-tv/

https://mywakenews.wordpress.com/2020/07/11/freedom-alert-special-guest-charles-erwin-united-we-start-roundtable-discussion-july-11-2020/

https://mywakenews.wordpress.com/2020/07/07/in-den-fangen-korrupter-re-gier-ungen-und-krimineller-billionare-wake-news-radio-tv/

https://mywakenews.wordpress.com/2020/06/30/die-masken-tyrannorei-der-wenigen-uber-die-welt-wake-news-radio-tv/

https://mywakenews.wordpress.com/2020/06/30/unsere-erde-ein-kleines-paradies-wir-menschen-konnen-das-wenn-wir-wollen-wahr-da-was-talk-mit-michael-gast-claudia/

Interview mit dem mutigen Pfarrer Jakob Tscharntke
https://musicwakenews.wordpress.com/2020/06/26/913/

https://mywakenews.wordpress.com/2020/06/16/heisser-herbst-2020-wake-news-radio-tv/

https://mywakenews.wordpress.com/2020/06/13/world-in-turmoil-live-show-20200613-with-guest-larry-pinkney-unitedwestart-roundtable-discussion/

https://mywakenews.wordpress.com/2020/06/09/wir-erleben-gerade-die-umsetzung-der-neuen-welt-ordnung-wake-news-radio-tv/

https://mywakenews.wordpress.com/2020/06/02/konzentration-auf-das-wesentliche-es-geht-um-unser-aller-freiheit-wake-news-radio-tv/

************************************************************************************

https://mywakenews.wordpress.com/
http://schuldnervereinigung.wordpress.com/
https://vugwakenews.wordpress.com/
http://wnradiotv.wordpress.com
http://wnanzeiger.wordpress.com/
http://wakenewsvital.wordpress.com/
https://survivalwakenews.wordpress.com/
https://aufgewachter.wordpress.com/2012/02/25/inhaltsverzeichnis-best-of-detlev-wake-news-radio/

Allgemeine Links:

anzeigerbanner WN-Anzeiger o. SV

Abb.: Wake News

http://wnanzeiger.net/
http://wnanzeiger.wordpress.com/

ACHTUNG! Manchmal erscheint hier kommerzielle Werbung! Die ist nicht von Wake News geschaltet bzw. erwünscht! WordPress schaltet die hier auf eigene Veranlassung ein – es handelt sich um einen kostenlosen Blog!

Über mywakenews

For all who want to wake up! Für alle die aufwachen wollen! http://wakenews.net
Dieser Beitrag wurde unter Uncategorized abgelegt und mit , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , verschlagwortet. Setze ein Lesezeichen auf den Permalink.

56 Antworten zu Diktatur der Satansbrut – Wake News Radio/TV

  1. Jochen schreibt:

    Zitat: „Der satanische Bezug zur Corona-Krise

    Der Begleitstern der Neuen Weltordnung, die römisch-katholische Melinda Gates, erscheint in der „Today Show“ mit einem umgekehrten Kreuz und drängt massiv auf eine GLOBALE IMPFUNG“

    Zitat Ende. Quelle: https://endzeit-reporter.org/2020/07/28/vorboten-der-truebsalzeit-teil-56/

    Das Kreuz ist eigentlich ein Symbol für das Leben, das Sein, also ist das umgekehrte Kreuz ein Symbol für den Tod. Schon Shakespeare stellte die Frage nach dem Sein oder dem Nichtsein. In der Bibel betrifft das den Kain (Leben) und den Abel (das Nichtsein), also den Menschen und den Wurm (Nabelschur), den Erstgeborenen (hebr. Barabbas „Sohn des Vaters“) und den Christus, als ein Bild auf den Abel.

    Psalm 22:6 Ich aber bin ein Wurm und kein Mensch, ein Spott der Leute und verachtet vom Volk.

  2. Solist schreibt:

    Zu den GEPLANTEN Impfungen für… äääh…. gegen Covid (Nicht existent) gab es ja auch einige Videos: RNA/DNA verändernd, evt. NANOBOTS darin, die im Körper andocken und nicht mehr ausgeschieden werden….
    Wenn dann aber andocken, könnten bei Bluttests auch nicht mehr gefunden werden? Rein theoretisch, da ja nicht im Blutstrom mehr schwimmen? Anders wie andere Nanopartikel, wie ja ein Prof Montanari bei hundert Impfseren bisher entdeckt hatte, die KREBS auslösen, mit EINER Ausnahme, einem Impfserum für TIERE. Das Impfungen Krebs machen, sagte ebenfalls ein anderer Prof. ohne Montanari oder seine Ergebnisse einzubeziehen, anzusprechen.

    Natürlich werde ich mich freiwillig auch nicht testen lassen, zumal Corona eh ein Hoax ist und die Zahl der ANGEBLICH Infizierten eh schon VORHER feststeht (festgelegt wurde, da der Faketest so gemacht wurde, damit soundsoviel Prozent positiv herauskommen, Sie könnten auch gezielt Menschen oder Menschengruppen positiv testen lassen, wie Sie lustig sind.

    Ich erinnere an Tansanias Präsident, der von Tieren, Pflanzen, sogar Motoröl (also komplett unbelebt) Proben nehmen lies, Ihnen menschl. Identitäten gab, als Namen, Alter, Geschlecht und testen lies. Der Test konnte nicht mal bemerken, das es keine Menschen waren und fand prompt Coronabetroffene… Ne Papaya, ne Ziege und mind. noch ein dritter Probant, öhm… was ich nicht mehr erinnere, einige waren unbestimmt, andere negativ.

    CYBORG-Insekten sind Realität!

    25.07.2020
    InteressanteWelt

    PROPAGANDA (Virus-HOAX):
    Putin Warns of Second Coronavirus Wave for Russia This Fall
    https://www.themoscowtimes.com/2020/05/22/putin-warns-of-second-coronavirus-wave-for-russia-this-fall-a70357
    May 22, 2020

    Medienmanipulationen auf Mallorca

    Attila Hildmann die installierte Puppe [2k 1440p]

    Technotise (Anime-Film von 2009)
    Belgrad in der nahen Zukunft, 2074: Edit studiert Psychologie und steht mit einem bestimmten Examen auf Kriegsfuß. Nachdem sie das sechste Mal durchgefallen ist, lässt sie sich einen gestohlenen Militärchip implantieren, der ihre Erinnerungen aufzeichnet. Edits Bekanntschaft mit dem Mathematik Genie Abel führt sie zu einer mysteriösen Formel, die dank ihres Chips berechnet werden kann. Doch der Chip entwickelt eine parallele Persönlichkeit, die Macht über Edit gewinnt – kann sie die Technologie in sich selbst besiegen und ihre Menschlichkeit bewahren?

    Sløborn (Deutsch-dänische Serie von 2020)
    Die Sozialarbeiter Freja und Martin kommen mit einer Gruppe von straffällig gewordenen Jugendlichen auf eine Insel. Als zwei Leichen gefunden werden, sind die Inselbewohner zunächst mit ihren persönlichen Problemen zu beschäftigt, um die tödliche Gefahr rechtzeitig zu erkennen. Schließlich jedoch fräst sich das tödliche Virus (Taubengrippe) durch die Inselidylle und übernimmt die Herrschaft über den Alltag und das Bewusstsein der Menschen.

    The Hater (Spielfilm 2020) NICHT angeshen:
    Eine postkommunistische Gesellschaft in Europa: Der Jurastudent Tomek (Maciej Musiałowski) ist in Ungnade gefallen und versucht mit allen Mitteln, seine Kindheitsfreundin Gabi (Vanessa Alexander) auf sich aufmerksam zu machen. Außerdem möchte er den Respekt ihrer Familie bekommen. Tomek nimmt darum einen Job in einer PR-Agentur an, die bekannt ist, aber mit moralisch zweifelhaften Methoden arbeitet. Damit will er Gabi beeindrucken. Er merkt schnell, dass er sehr gut ist in seiner Arbeit: Er manipuliert in den Sozialen Medien auf perfide Art die politische Meinung. Doch diese Arbeit bleibt nicht ohne Folgen. Stück für Stück verliert Tomek seine Menschlichkeit. Bald erkennt er kaum noch, worum es im Leben wirklich gehen sollte …

    Heute, ZDF, 12,00 – 12,10:
    Nur einen Teil mitbekommen, erst Erdogan im Livechat mit Usern…. dann… sei nur ein Vorwand für Einschränkung der Meinungsfreiheit in den sozialen Medien, so ungefähr… SEHR witzig, also das Gleiche wie bei uns.
    Kurz danach., nun sei ein Kunstwerk eines hochpolitischen kritischen Künstlers verkauft worden (vielleicht auch drei zusammenhängende, da Drei im Bild gezeigt wurden und zusamengehörend?) (den Ton hatte noch leise) für den Preis von 2,4 Millionen. Es ging um Kritik an der Flüchtlingskrise, in Bild gezeigte so genannte Flüchtlinge im tosenden Meer, die gerade ertranken. (hochpolitisch kritisch? Erneut ein schlechter Witz, Kritik wäre genau das Gegenteil gewesen, was die Lügen und Flutung von Asylanten verurteilt hätte, genau auf polit. Agenda-Schiene).
    Alles wird ins Gegenteil verdreht.

  3. Solist schreibt:

    RKI kündigt Abschaffung der Wissenschaft an: „nie hinterfragen“. Rückfragen nicht „sinnvoll“

  4. Solist schreibt:

    DIE LETZTE GROSSE TÄUSCHUNG! TRUMP UND Q ZERSTÖRT!
    https://www.bitchute.com/video/c1uP7aoofsjT/

    Ohne Worte, obwohl ich die Gesangskunst durchaus geniessen kann, ABER….
    Dimash kommt aus Kasachstan (NWO Hauptstadt AStana), schon öfter getextet und gehört zu den weltbesten Sängern, mir fiel noch mehr auf in Videos, aber nur als Beispiele (ebenso gibts Songs-Videos welche die Agenda befördern, We Are One, oder zu Notre Dame ect.), achtet auch auf die Optik
    Dimash Kudaibergenov — Ogni Pietra

    Dimash Kudaibergen – Across Endless Dimensions

    Dimash Kudaibergen – Passione ~ New Wave 2019 [New Song]

  5. pam schreibt:

    Erlebniss Stuttgart:
    „Halte Abstand und das war es „.

    war heute das erste mal seit diesem hoax Corona im Kaufland einkaufen ohne Mund Schutz ,( Bisher nur in Netto, da hatten sie mich nie zurecht gewissen. ) Und wie gesagt Straßenbahn eh ohne Mundschutz. Mit Wissen, Glauben und mit Selbstsicherheit macht dich auch niemand an.
    Halte meinen Abstand und es ist gut.

    War ein anderer Fall:
    (Außer du triffst auf einen der zu viel Alkohol getrunken hat. ich wünschte Ihm Gottes Segen zwei mal. als er mich als Fotze und Drecksau beschimpfte.
    Er tat mir leid, ich machte ihn auf dieses Aufmerksam in Ruhe.)

    Die Verkäuferinnen bedienten mich sogar sehr freundlich.
    Hatte das Gefühl sogar gehabt, das sie nur auf uns Verbraucher warten.
    Gottes Segen alles wird erst mal gut, da bin ich mir sicher.
    Es ist ein Aufwach– Prozess

    Siehe Offenbarung, vielleicht habt ihr ja jetzt Lust diese zu Studieren. Aber es geht nicht ohne Gott Segen.

  6. pam schreibt:

    diese Selbstbewusstsein. sind wir alle jeder einzelne.Das heißt wir wissen es und vermuten nicht,
    Genauso laufen wie durch die Straßen
    Wer kann gegen dich sein, wenn Gott mit dir ist, muss das echt eine einfache Sonderschülerin erklären. Gott stehe mir bei.
    Gottes Segen.

  7. pam schreibt:

    Erfahrungen:

    Durch ein Buch, bin ich erst wach geworden mit 17 Jahre, naiv und dumm, schwach in Erinnerung wie er hieß, weis ich leider nicht mehr , aber ich würde es heute noch mal gerne lesen, er hatte beides Gott und das Leben,
    leo buskalia.?! I weiß es leider nicht mehr.( Habe diese bis heute gesucht )
    Danach war ich auch noch dumm, aber es hat mich geprägt im Guten und geführt.
    Viele Bücher hatte ich gelesen Fernseher war mir nicht damals so wichtig,

    Was ich nicht potenziell hatte war Schule bildend in meinen Anfängen 1965. auf dies hatte ich keine Lust.
    Gott führt und lenkt einen

  8. Jochen schreibt:

    Wichtig!

    Erneuter Lockdown – bereits beschlossen? – Ende August 2020??? (gefunden auf https://bumibahagia.com)

    Immer bereit sein ist alles.
    Der Zusammenbruch kommt auf jeden Fall.
    Es ist so gewollt.
    Die Leidtragenden sind die Menschen.
    Das Übel sind die Eliten (http://www.namen-namensbedeutung.de/Namen/Namen-Isra.html).
    5.Mose 25:19 Wenn dir nun der HERR, dein Gott, Ruhe gegeben hat vor allen deinen Feinden ringsum im Lande, das der HERR, dein Gott, dir als Erbe einzunehmen gibt, so sollst du das Gedächtnis Amaleks unter dem Himmel vertilgen; vergiß es nicht!

    Amalek ist eine Bezeichnung der Kinder Israel für die Deutschen und deren Vorfahren.
    Das Ende ist nahe. Fragt sich nur: Das Ende letztendlich von wem?

    Offenbarung 12:12 Darum seid fröhlich, ihr Himmel, und die ihr darin wohnet! Wehe der Erde und dem Meere! Denn der Teufel ist zu euch hinabgestiegen und hat einen großen Zorn, da er weiß, daß er nur wenig Zeit hat.

  9. Solist schreibt:

    Amalek, hat ein Jude so dargestellt: Wenn DIE (andere Juden, Israel…) von Amalek reden, meinen Sie Jene, die EINEN GENOZID verdient haben, also zerstört werden wollen, vernichtet und Rabbis/Juden usw haben ja schon genug asoziale Aussagen rausgehauen, das wir abgeschlachtet werden sollen z.B. nicht nur sterben, sondern leiden…. ein Anderer vor der Knesset, wollte das Atombomben auf deutsche Grossstädte abgeworfen werden. Also in Sachen Orwell ist Jochen ein Meister.

    Falschmeldung? Was plante Reporter vom Mannheimer Morgen? Noch vor Ort zur Rede gestellt

    Dieser weisse Weissenhasser will auch Vernichtung und Leid:
    Die wahren Ursprünge von Black Lives Matter
    https://donnersender.ru/video/die-wahren-ursprunge-von-black-lives-matter
    Es gibt eine Illuminati Spielkarte die Black lives Matter ankündigte (1982-1995 erschienen), googlet danach. Trump ebenfalls auf ner Karte, wie Obama, der 9/11 auf zwei Karten usw.

    Die wahren Rassisten
    https://donnersender.ru/video/die-wahren-rassisten
    BITTE BIS ZU ENDE ANSEHEN

    Noch was zur Entspannung:
    Angelina Jordan – I Put A Spell On You

    Zum Zeitpunkt der Aufnahme war Sie 9 Jahre alt.

    Immortal Songs 2 – 포레스텔라 – Bohemian Rhapsody.20190223 -Forestella 🤗👏👏👏

    YT: Forestella – Heal The World Immortal Songs 2

    YT: Forestella – Nella Fantasia

    FORESTELLA – Hijo de la Luna
    YT: 포레스텔라 – Hijo de la Luna (달의 아들) [열린 음악회/Open Concert] 20200524

  10. Solist schreibt:

    Nachtrag: Da hatte bei Jochen gerade wohl zu selektiv gelesen, trotzdem insgesamt doppeldeutig und nachdem, was eben früher schon brachte, wie das glorifizierende Armageddon. Denver Airport Wandgemälde mehrfach z.B. und immer nur einseitig und nur positiv gedeutet und ebenfalls nur Bilder passend herausgepickt und da die Bibel und das alte Testament eh… von den SELBEN kommt die uns feindlich, die meinen die Auserwählten zu sein…. als auch kein Wunder…. und da seit tausenden Jahren schon ihr Unwesen treiben oder wie lange auch immer…. und uns manipulieren, die Geschichte lenken und schreiben….

  11. Solist schreibt:

    Nächster Lockdown bereits geplant?

    Kommentare darunter:
    Bubi 49
    vor 7 Stunden
    Ich freue mich auf die nächsten Repressalien da es leider noch viele Menschen gibt die meinen es ginge ihnen gut, wozu dann auf die Straße gehen? Berlin 1.08.20 hat gezeigt das es immer mehr Zweifler werden, und es muessen viel mehr werden!

    B
    vor 11 Stunden
    Aber gestern wurden die Menschen wieder total verarscht!!! Alles ist manipuliert!!! Auch dieser Widerstand ist gelenkt!!!
    Das war die letzte Chance, leider vertan!!!
    😱😱😱🤮🤮🤮🤮Meiner Meinung nach hat die Demo der Sache nur geschadet, siehe den Bericht in den msm. Jetzt werden daraus noch strengere Maßnahmen eingeleitet!!!
    Denken!!!

    Steffan Tatkraft
    vor 8 Stunden (bearbeitet)
    So sehe ich das auch. Die Ignoranten und Mitläufer dürfen nun verdient mitleiden. Wir sind härte gewohnt.

    Doch verwechselt nicht die vielen opportunistischen Egoprotestler mit jenen Gegenbewegten philosophischer Ablehnung mit diesem Zeitgeist.

    Der Globalismus ist unser grosser Gegner. Event 201. Das muss auf so einer Demo klar rüberkommen. Wurde aber wohl nicht gemacht. Minderheiten und Religionen sind nur Werkzeuge der Macht.

    Auf der Demo waren viele Zersetzte Clowns, Gutmenschen mit persönlichem unwohl und utopischem, linksgleichem Wunschdenken.

    Es sah aus wie Dabei sein ist alles. Wenig Message, Party, Chaos.

    Was die Medien daraus machen können, das tun sie selbstverständlich.

    Nach innen hat es dennoch seine Funktion der Stärkung des Zusammenhaltes gehabt. Das zählt.

    Bernd Thiel
    vor 8 Stunden
    @Steffan Tatkraft , aus meiner Sicht eher eine peinliche Form der Revolution .
    Aber Du hast es perfekt beschrieben : Wenig Message , Party , Chaos . Das war ein Rohrkrepierer ! ( unfreiwillig – freiwillig )

    Suzanne Bellekens
    vor 5 Stunden
    @B Ich denke, dass du leider Recht hast 😥

    Tyre Wald
    vor 4 Stunden
    Diesmal mit 3 Monaten Stubenarrest.

    • MFG-Hamburg schreibt:

      das sind die typischen beiträge von bezahlten schreibern, die natürlich alles schlecht reden oder versuchen es geschwächt aussehen zu lassen. die mehrheit der demoteilnehmer hat erkannt, sie stehen einem faschismus gegenüber. DAS läßt sich nicht mehr rückgängig machen. die leute sind überzeugt, ihnen werden die menschlichen grundrechte entzogen. es zeigt ebenfalls auf, man hat sich garnicht wirklich damit beschäftigt, die leute beginnen sich zu organisieren, weil sie bemerkt haben, sie kommen nicht mehr weiter. das ist nicht das ende, sondern der beginn……natürlich wird die neue weltordung alles mögliche tun, um diese bewegung aufzulösen oder zu instrumentalisieren.

    • Solist schreibt:

      Bei der genehmigten, dann untersagten Demo in Berlin, mit massig Menschen… ich frage mich, wie da so Viele und von Wem Alles darüber informiert wurden und der BILD-Bestsellerautor Torsten Schulte (Pro Trump „Aufklärer“ und..).. war wohl separat auch dort, zumindest wurde es angesprochen, wo Jemand dort das geschehen 5 Stunden filmt, eigentlich mehr sich und einzelne Leute, auch die Polizei und Massen, aber nicht zig Gespräche mit umstehenden fremden Besuchern geführt., paar Bekannte, auch wenn nicht die ganzen 5 Stunden am Stück abgesehen und bewusst angehört hätte, selbst wenn Ausnahmen dabei gewesen.. aber mehrheitlich wohl nicht. Das Erste… der erste der im Bild und Ton war ein Nana, von Dem hatte früher was gesehen, halte nicht viel von, ein Schwarzer übrigens, dann war im großen Bild ein kleines Bild mit anderer Kamera eingeblendet, da sah man ne REGENBOGENflagge, wie bei WAGENKNECHTS Ramteindemo schon, das steht für VERMISCHUNG und Pro Flutung, bei anderer Demo, länger ZUVOR, mit Plakat: Aufstehen gegen Nazis. Dann war SCHRANG dran, ein verstrahlter Lakai, mir einem Kollegen dabei und hat geblubbert und Beide mit Shirt mit illuminierter symboik darauf. Ein Kreis in einem Strich und darin ein sehr kleiner Punkt. Dann war Zion Janich, der nicht selbst dabei, aber entweder als Shalte übertragen oder nur den Ton oder zuvor aufgenommen, der es bedauerte nicht selbst auftreten zu können (de ja auf den Phillippinen lebt).
      dann also die Polizei, die es untersagte, gegen die vielen Demonstanten ging nicht vor, aber mehr konnte nicht gebracht werden, der aufnehmende Redner nahm das alles sehr entspannt, Für Die war es ein Erfolg.
      Also auch das nicht neu, auch bei Pegida ne Demo, erst genehmigt, dann wurden eingekreist, ein linker Pressefritze warf nen Böller, damit gegen die Demonstranten vorgehen konnten und die auflösen, forderten die Besucher dazu auf, was aber nicht ging, da eingekreist zuvor wurden, die Presse hatte ihre Fotos und behauptete,die Demoteilnehmer wären gegen die Polzei losgegangen. Als Anwesende den Böllerwerfer, der es zündende, direkt nur Meter von Polizei weg und dann unbehelligt verschwand, sich später in sozialen Netz mit seiner Tat brüstete, mit linken Schlagworten… also Die wolten von der Polzei Strafantrag gegen den Böllerwerfer stellen, die Polizei WEIGERTE SICH.
      Abe Pegida, wie Mahnwachen, wie Widerstand 2020, mit eigener Partei, wie gelbe Westen, auch von VS Mann Rüdiger Klasen/Hoffmann ins Leben gerufen, der
      NEUE WELTORDNUNG mit Russia will, sagte Er selbst…..
      Also so ziemlich JEDE Demo zeigte sich als gesteuert, Jede größere Bekannte und meist mit Renern die zudem Lakaien. Mahnwachen, Friedensdemos…. natürlich die üblichen.. Klimademos usw, Die sowieso klr als vom System und während Antifa in France bei gelben Wsten dabei, waren zeitgleich in BRD gegen, aber jetzt eben LINKE und.. auch wieder an Seite und auch brei früheren GESTEUERTEN Demos war die Antifa als Antithese. Es ist IMMER DAS GLEICHE. THESE UND ANTITHESE
      Die erfahren, schon durch Genehmigung, was laut GG nicht musst, ewenn nachgewiesener deutscher bist…. dasfst dich nach GG frei versammeln… OHNE ES GENEHMIGEN ZU LASSEN…. dann spätestens wissen DIE ES AUCH und wussten auch das in Berlin Viele kommen und damit war im Vorfeld klar, was da abläuft. Was in France gelaufen ist und mit der Eurogendfor und bezahlte Chaoten, die Auots anzündeten, Scheiben anschlugen und Macron nutze es für seine Massnahmen gegen das Volk und JETZT wsehen wir wieder das Gleiche, ich denke es dient einer Mehrfachstrategie und wir dem Ostebn und Kommunismus eh in die Arme getrieben werden, ALLE REVOLUTIONEN Eliterngeplant, Sie können den Demobesuchern dann die sxchuld geben oder…. es gibt zig Möglichkreiten, Varianten, wir werden nur noch immer mehr gefickt, wie zuvor schon. Und was haben die Demos gebracht? Was lief sogar bei Stuittgart 21 ab? Ein Kompromiss (der KEINER WAR) am Ende durch Vermittler der Demo und nem Altpolitiker und Jesuit, glaube Ich, Heiner Geisler oder Geissler? (Geiss=Ziege, womit wir bei Baphomet wären, aber gut, will nicht zuviel reininterpretieren), dem man vertrauen könne und das Ding wurde durchgezogen
      Bodo Schiffmann, Fiddicke… alles falsche Fuffziger und Systemhuren, Schiffmann noch so ne linke Socke, der sich als EU Befürworter und Weltbürger bezeichnete.
      Soollen sich all zum Teufel scheren.
      Wer für Massenmörder arbeitet und Massenmord zuarbeitet…. neben weiteren Kleinigkeiten. Was könnte ich von Solchen wohl halten?
      Was könnte ich Denen wünschen?

    • Solist schreibt:

      Ah, ja, das aufgezeichnete Material war bei Klagemauer.TV, nochmal… die ich auch noch velinke, aber IE Putin und den Osten beleuchten, NICHT EINMAL in all der Zeit, auch wenn mich dauernd wiederholen muß und im YT-Begleittext steht, daß RT deutsch das auch unterstütze oder so ähnlich. Alles klar… Warum nennen sich eigentlich Klagemauer? Wo gibt es Klagemauer? In Israel, oder? Und Klagemaue wurde auch mehrfach attackiert und Server gehackt, zumindest behauptet. These und Antithese….
      Und auch wenn es stimmt und der Eine nichts vom Anderen als Mitspieler wüsste und das Spirl läuft ebe überall so Demos und Gegendemos, Ost vs West, sogar Arbeitnehmer vs Arbeitgeberverände, sogar Vereine Selbsthilfeorgs usw. Z.B. wird dann gerne von der Pharmalobby finanziert… Verbraucherverbände, FRÜHER hielt Stiftung Warentest für hoch seriös ect…. Einfach nichts wird dem Zufall überlassen.
      Der jüd. C.Hörstel, dessen Bruder ein hoher Bankster ist, Er drei Parteien gründete und nach AUSSEN gegen die Rothschilds stellte und das Schuldgeld, während sein Bruder aber… außerdem ebenso Islamisierung will usw usf. Damit klar ein Systemlakai und FEIND der Deutschen und sogar Einheimischen und da für NWO und deren Pläne letztlich gegen alle Menschen und die Asylanten nur nützliche Idioten auf dem Weg zum Ziel und ja Milliarden verschwinden sollen, von der Erde, auf welchen Wegen auch immer, Ganz Europa hat nicht mal ganz ne Milliarde, also wird es auch die Lieblinge der LINKEN treffen, Sie selbst natürlich auch. Diese Vollpfosten oder ihren Nachwuchs oder Verwandte und…

      Die EURASIEN – Agenda ( Rote NWO aus dem Osten)
      https://altcensored.com/watch?v=Imjws8QMWZg

      ZIONs internationale Rotfront Koalition
      https://altcensored.com/watch?v=pmS4AgtjjgA

      Die Agenda des 21. Jahrhunderts (AGENDA 21)
      [video src="https://archive.org/download/youtube-Oy_X1sQEgTE/Die_Agenda_des_21._Jahrhunderts_AGENDA_21-Oy_X1sQEgTE.mp4" /]

      Die kommunistischen Vereinten Nationen UNO
      [video src="https://archive.org/download/youtube-QKzN2g2ntI8/Die_kommunistischen_Vereinten_Nationen_UNO-QKzN2g2ntI8.mp4" /]

      Der Blutrote Oktober – Globale Revolution und Transformation
      https://altcensored.com/watch?v=wnPzYVnWBBc
      https://vids.theoven.lol/v/662
      Henry Kissinger übergab dem deutschen Präsidenten eine von ihm erarbeitete Studie, nach der die Russen keine großangelegte Strategie verfolgen. Warum? Weil er ein Agent der Sowjets ist bzw. die Rotschild -Agenda der Eine – Weltregierung vorantreibt. Bis zum Mauerbau liefen 300 Stasileute über, dann noch einmal fünfzig nach 1971 sowie 150 Geheimdienstler der Sowjets. Durch sie erfuhr man etwas über die Hintergründe der Perestroika, doch die Erkenntnisse wurden zurückgehalten. Es gehört zur Langzeitstrategie des Kommunismus, sich selbst aufzugeben, dadurch dem Westen zu täuschen, diesen dann zu unterwandern, von innen heraus auszusaugen und sich dann unter verschiedenen Deckorganisationen an die Macht zu schwingen. Was heute unter dem Begriff Überwachungsstaat, totale Weltkontrolle läuft, ist nichts anderes als Kommunismus, also ein gehirngewaschenes, gechiptes Weltsklavenheer. Kommunismus heißt ja immer Weltkommunismus, Internationalismus, und das eben ist die Neue Weltregierung unter dem Vorsitz der Rothschild-Sippe und seinem Dutzend anderer Hochfinanz-und Hochadelsgeschlechter. Offensichtlich arbeiten Kommunismus und Kapital zusammen und behindern sich nur äußerlich zur Täuschung der Massen; es geht ja letztendlich um globale Versklavung, gleichgültig unter welcher Ideologie.

      Das sowjetische Feindbild ging 1990 bei uns verloren. Die naive und unterwanderte Friedensbewegung fordert daher die Entmilitarisierung des Westens und die Beschneidung des Familienunternehmertums unter dem Deckmantel des Umweltschutzes. Wir stehen heute einer schleichenden Sowjetisierung durch Auflösung des Nationalbewusstseins. Deutschland nennt man die DDR 2.0 . Die wahren Väter der kommunistischen Ideologie sitzen jedoch nicht in Moskau, sondern als Hochfinanz in den internationalen Bankenzentren.

      Gewiß muß erkannt werden, daß ein Name lediglich ein Etikett ist. Einen Namen zu ändern, heißt nicht auch schon, die Essenz der Sache zu ändern, die mit diesem Namen verbunden war. Diese große Wahrheit wurde nicht berücksichtigt in Hinblick auf die Veränderungen in Osteuropa und der Sowjetunion. Wir haben neue Namen in Rußland, aber wir haben auch – wie Alexander Solschenitsyn hervorhob – ‘dieselben alten Gesichter’.

      Die kommunistisch – kapitalistische Diktatur beginnt mit:

      – Einschränkung der Ausfuhr von Geld

      – Geldtransaktionen mit Nummern versehen, die gespeichert werden

      – Gold wird verboten

      – Abschaffung des Erbrechtes oder starke Besteuerung

      – Verstaatlichung bzw. Kollegtivierung der Kindererziehung, Kinderhorte für Säuglinge

      – Auflösung der Familie

      – Jede Opposition wird unterdrückt

      – Keine Privatsphäre, kein Privatbesitz

      – Die kommende Währungsreform bzw. Abschaffung des Bargeldes macht Bargeldreserven wertlos, dann werden Computerchips (RFID?) in Kleidung, auf allen Objekten und im Gehirn eingeführt.

      – Der Verlust von individueller Identität ist ebenfalls geplant und im vollen Gange, ebenso die Auflösung ganzer Kulturen, daher der gezielte Zustrom von Afrikanern und Asiaten nach Europa, dadurch wird derzeit die Einheit der Europäer zerbrochen.

      Die Lüge vom Ende des Kommunismus

      http://www.metropolico.org/2013/05/14/die-luge-vom-ende-des-kommunismus/

  12. Solist schreibt:

    Putin zum Impfen auf deutsch

    03.08.2020

    —–

    https://altcensored.com/watch?v=N4IMXiFXqEA

  13. Solist schreibt:

    Ich kopiere mal von einem YT-Video einen Kommentar hier ein, mit allen bisherigen Antwortkommentaren. Ich lasse aber Verlinkungen in einem Kommentar von mir weg und eine weitere Antwort lasse ganz raus, wo ausschliesslich aus Verlinkungen besteht. Ich möchte absichtlich das Video, wo es war, nicht einfügen, aber vorneweg: Die/Der User/in: Die Hinterfragerin ist nicht koscher und hatte ich, nur dem Namen nach in unguter Erinnerung, ich erinnere nicht mehr, was Sie anderswo textete, aber habe Sie in eine Richtung eingeordnet, die eben zum falschen Lager zählte, ganz sicher war mir nicht, aber es verfestigte sich dann noch später und zudem der Kanalbetreiber auf gepflegten Umgang Wert legte und eh nicht man zu den Aufklärern zählen kann, Er hat sein Gebiet, was auch interessant, ABER…. und leider, leider, auch Corona in fast jedem Video erwähnte, die Pandemie, ich auch schon mehrere Male schrieb und dazu verlinkte, das es kein Corona gibt und wenn man es schon nicht deutlich herausstellt, da dann Videos ja zensiert werden könnten, zumindest es nicht noch bewirbt und mit Fragezeichen verbal vershen könnte oder entsprechend betonen, Gänsefüsschen mit der Hand wäre ne Möglichkeit dazu oder… und da sowieso täglich Kommentare im Netz verschwinden… nuja…
    Außerdem, wie Jemand, auch mehrfach in Videos sagte, Corona ist nicht der Grund, das die Wirtschaft gegen die Wand fährt ect.. sondern die umgesetzten Massnahmen, also das könnte man doch wenigstens hervorheben, wobei dieser Kanalbetreiber aber noch mehr Kritisches sagt, es nicht dabei belässt… und wenn man auch noch in dem Gewerbe arbeitet, wie, wo ich gleich die Kommentare bringe, wo „Gesundheitsmassnahmen“ ne Rolle spielen, Impfungen, gerade da sollte man doch erwarten… naja:

    Barren und Münzen
    vor 18 Stunden
    Für mich persönlich ist eines ganz klar, wenn es einen zweiten Lockdown gibt, sieht es sehr sehr schlecht für die Wirtschaft aus, nicht nur in Deutschland, sondern weltweit. Für Edelmetalle ist das vermutlich gut, leider wird es in so einem Fall sehr sehr vielen Menschen sehr schlecht gehen. Habe ich auch gerade bei mir angesprochen. Aktuell freue ich mich einfach über die steigenden Preise und hoffe, für das Wohl von Milliarden, dass es bei einem Lockdown bleibt. Wie immer ein sehr interessantes Video 👍 LG

    25

    Frank Herrmann
    vor 18 Stunden (bearbeitet)
    Es geschieht IMMER das, was die Elite plante, ob real ODER Fake, wie bei dem Coronaschwindel, der Fake ist.

    ANMERK: Hier folgten noch Verlinkungen.

    Uwe H.
    vor 16 Stunden
    Mittlerweile gibt es die Variante 100% Risikoübernahme durch die KfW – wurde im April beschlossen. Da fällt bestimmt auch gar nichts aus und wird kein Steuergeld verbrannt… Quelle: https://www.bmwi.de/Redaktion/DE/Pressemitteilungen/2020/20200406-bundesregierung-beschliesst-weitergehenden-kfw-schnellkredit-fuer-den-mittelstand.html

    Die Hinterfragerin
    vor 15 Stunden
    Barren Münzen
    Warum sieht es schlecht aus?
    Jeder Mensch der mit offenen Augen durch das Leben geht, weiß doch seit 2008 das das Finanzsystem zu Ende ist.
    Somit hatte jeder 12 Jahre Zeit sich auf das was jetzt Fakt ist, vorzubereiten.
    Von mir aus kann kommen und sein was will. Ich komme dir nächsten 30 Jahre gut über die Runden 👍🏼

    3

    Frank Herrmann
    vor 15 Stunden (bearbeitet)
    @Die Hinterfragerin Gut, wenn vorbereitet bist, aber deswegen geht nicht Alles an Dir vorbei. Glaube das nicht. Wenn Zwangsimpfungen oder… Chemtrails entkommst auch nicht, Vieles mehr. Manches könnte durch indirekten Zwang (und Manipulation der Massen sowieso) ZUERST auch erfolgen und den Rest knöpfen sich dann anders vor. Trump hat ja klar verlauten lassen, Impfungen mit Hilfe des MILITÄRS durchführen zu lassen, Impfzwang bei Kindern zu Masern jetzt schon in BRD, seit März…. Skalarwellen kannst nicht abschirmen. Geht durch Alles, selbst wenn im Bunker sitzt. Ich könnte noch die angeblichen Waldbrände in mehreren Ländern ansprechen, wo Hightechwaffen eingesetzt wurden und manch Häuser bis zu den Grundmauern verschwunden, ALLES, während Grünzeug keinen Schaden hatte oder kaum, teils nicht mal Bäume in Nähe usw. Wenn ganz entkommen willst, musst auf nen anderen Planeten. Es kann Enteignung geben oder man muß sein Heim verlassen, Nahrung kann gestohlen werden usw. Also selbst WENN Nahrungsmittel für 30 Jahre hättest und irgendwann brauchen die Meisten mal nen Arzt ect. oder Umstände es noch wahrscheinlicher machen könnten usw.

    Ich plädiere genauso, sich vorzubereiten, ändert aber nichts dran, das es wirkliche Sicherheit nicht gibt und der NWO kannst auch nirgends entkommen. Für 30 Jahre in nem Bunker wäre nicht erstrebenswert, aber.. ich hätte türlich gerne sowas, wo dann autark von Allem, Strom, Wasser, Abwasser müsste abgeführt werden, gefilterte Luft ect sehr lange überleben könnte.
    Außerdem hast Du sicher Bekannte oder Freunde… was ist mit Denen? Geschweige wenn Kinder vorhanden (ich z.B. nicht, aber soll ja vorkommen).

    2

    fred freden
    vor 15 Stunden
    @Die Hinterfragerin das problem wird sein, das wenn es richtig gegen die wand geht und die leute anfangen zu hungern, werden sie sehen das du gut genährt bist und mal anklopfen woher das kommt.
    ergo, was hst du davon das es dir gut geht wenn vor deiner tür der horror abgeht- richtig , nichts.

    2

    Die Hinterfragerin
    vor 15 Stunden
    @Frank Herrmann
    Alles geht an mir vorbei.
    Wenn man gut vorbereitet ist, geht alles gut an einem vorbei 👍🏼

    Die Hinterfragerin
    vor 14 Stunden
    @Frank Herrmann
    Was interessieren mich meine Verwandten?
    Soll ich in etwa jemanden helfen, die mich ohnehin seit Jahren nur einen spinner, oder Verschwörungstheoretiker nennen?
    Mal sehen wer Autark über die Runden kommt.
    Ich weiß schon wer das sein wird.
    Nämlich nur die Menschen die eben gut vorbereitet sind 😉

    2

    Die Hinterfragerin
    vor 14 Stunden
    @fred freden
    Die Leute werden gar nichts sehen, da sie mich gar nicht sehen werden.
    Das ist der springende Punkt.
    Und es werden weder Freunde, Verwandte und Bekannte wissen, wo ich bin 😁
    Und irgendwann wenn alles wieder vorbei ist, bin auch ich plötzlich wieder da 😁

    Frank Herrmann
    vor 14 Stunden (bearbeitet)
    @Die Hinterfragerin Das war nicht wirklich ne Antwort, die etwas erklärt. Ich hoffe, gehörst nicht zu der New Age Religion die häufiger im Netz oder vielleicht bist gläubig und sagst. Leben, Leiden, Tod… egal, was kütt, das kütt? Dies scheint aber deiner Aussage zur Vorbereitung zu widersprechen,, also würde sich nicht für mich zusammenreimen lassen.
    Naja, So kann ich nicht wirklich antworten, ohne Infos. Wie auch immer. Solange noch im materiellen Körper bist, betrifft es Dich auch. Manche reden jetzt so, aber wenn Sie dann in anderer Situation erst mal stecken, wird Sie das wieder auf den Boden der Tatsachen holen, ob Sie nun blicken, WARUM es geschehen ist, ne andere Frage, Du zumindest musst ja Etwas wissen, nach deinem Text (wie gut oder in welche Richtungen informiert, weiß ich natürlich nicht), Ich hatte Dich auch schon gelesen, nur was Wer wann textet, kann ich mir eh nicht merken.

    PS. Es wird nie vorbei sein, solange, wie seit JAHRTAUSENDEN die Ursache am Ball ist, die nur mächtig, dank ihrer vielen Lakaien WELTWEIT. Q Anon ist auch deren PSY-OP, wie Fiulford und 90 Protzent der Aufklärerszene dient IHNEN, mit teils Lügen, verschweigen ect.
    Es gibt kein abtauchen und danach ein Garten Eden, Wer das erzählt, verarscht dich, sollte Dies der Fall sein. Wie rauschen mit Volgas in die Weltdiktatur und Zombiefizierung der Menschheit. Der große Teil soll eh getilgt werden und für den Rest ist es dann VORBEI. Dann ist Planet Erde abgehakt. Dann gibts kein echtes Leben mehr.

    1

    Die Hinterfragerin
    vor 14 Stunden
    @Frank Herrmann
    Nur wer gut vorbereitet ist, wird gut über die Runden kommen.
    Dazu muss man natürlich auch eine kleine Stange Geld in die Hand nehmen.
    Da aber die meisten Menschen dem Konsum verfallen sind und ich mein Geld für nützliche Dinge verwende, werden die meisten Menschen so wie es aussieht, schlimme Zeiten vor sich haben.
    Naja, noch bin ich in meinem Körper.
    Zumindest physisch 😉

    Frank Herrmann
    vor 14 Stunden (bearbeitet)
    @Die Hinterfragerin Erstmal, ich habe meinen Text ergänzt, da auch deine Antwort an Fred gelesen hatte.
    Für mich klingt das, man möge mir verzeihen, vielleicht interpretiere es falsch, als ob Du oder Andere…., Leute kennen, die sich zu den „Bossen“ zählen und der Elite zugetan und Du deshalb denkst, Sie würden nach dem „Armageddon“ ein Paradies erschaffen ODER, wie die Chabad Rabbis, DANACH deren satan. Erlöser die tote Erde in ein Paradies verwandelt. Also für Dich scheint das kein Problem zu sein, auch nicht „verlorene“ dreissig Jahre und dann glaubst, das es ganz supi wird?
    Putins Chabad trägt den Namen Berel Lasar, Trump ist Chabadfan ect.

    Mal ne Analogie:
    Aaron Russo erzählte in Interview Alex Jones (der in Wahrheit auch ein Lakai) im Jahre 2007 zu seiner früheren Freundschaft mit Nikolas Rockefeller, kurz gefasst, sagte Rocky Ihm auch VOR 9/11, das bald ein Ereignis folge und…. außerdem das geplant sei, jedem Menschen einen RFID Chip zu verpassen.
    Er wollte Russo anwerben. Er sagte Ihm, wenn ein Polizist IHN (Russo) kontrollieren wolle, zeigt Er Ihm seinen Chip und dieser sagt dem Polizisten. Küss meinen Arsch und lässt Ihn in Ruhe.
    Jetzt denke mal weiter, damit wäre Russo ja GENAUSO deren Sklave und vollkontrolliert am Ende und würde Er was machen, was nicht gefällt und das DIE nicht wollten…. hätte die Konsequenzen und ruckzuck würde merken, das Er auch nur ein Sklave wäre, so wie Alle. Vielleicht würde es merken, wenn es zu spät ist und…. WENN Er sich darauf eingelassen hätte (Gut, er starb eh im gleichen Jahr, aber… theoretisch eben).
    Den Gläubigen wird erzählt, das es G_ttes Prophezeiungen wären, die sich erfüllen, komisch nur, das Soie es jedesmal selbst sind, KEIN Gott, auch kein Satan ect. und so wird auch kein Satan die Erde wieder herstellen.
    Am Ende wird es sogar den paar Tausend auf die Füsse fallen, davon haben wir zwar nix, aber…. Da ist komplett irre, was die machen. Da hilft keine Therapie mehr.

    Ein User im Netz, der verlinkte immer wieder zu den Wandgemälden im Denver Flughafen zum Armageddon. Aber er brachte nur selektiv das Ende, was scheinbar ein Paradies zeigt, den großen Rest davor hat unterschlagen, obwohl Ihn MEHRFACH darauf hinwies, aber in Wahrheit gibts am Ende KEIN Paradies, Sie stellen es nur so dar.
    Wie Zeugen Jehovas ihr Paradies.
    Netter Freimaurergrundstein dort, weitere Symbolik, draussen 2 Statuen: Apokalyptischer Reiter und Anubis-Gott des Todes….

    1

    Barren und Münzen
    vor 13 Stunden
    Die Hinterfragerin Ich finde die Einstellung alle anderen Menschen ins Elend rennen zu lassen, nur weil man selbst etwas gemacht hat, von dem man auch nicht wissen konnte, dass es funktioniert, genauso wenig, wie andere Menschen, die sich vielleicht mit Finanzen überhaupt nicht beschäftigen ganz ehrlich widerlich und abstoßend. Wer so denkt und wem das Leben von unschuldigen so egal ist, der verdient keinen Wohlstand, geschweige denn Reichtum. Das Einzige was ich dazu sage. Schönen Abend allerseits.

    2

    Die Hinterfragerin
    vor 7 Stunden
    @Barren und Münzen
    Doch, das funktioniert sogar sehr gut, sich nicht um den Rest der Welt kümmern zu müssen.
    Es genügt doch, seine eigene Familie durch schlechte Zeiten zu bringen.
    Der Rest interessiert mich einen (Scheissdreck).
    Ich kann mich nicht erinnern, daß mir in meinem Leben jemals jemand geholfen hätte.
    Im Gegenteil. Man hat auf dem Weg zum Erfolg jede Menge Neider.
    Und wenn man es dann geschafft hat, hat man nicht nur die Neider, sondern es gesellen sich plötzlich noch die Rasse dazu, die selbst ihr ganzes Leben immer zu faul waren einmal selbst ihr Leben in die Hand zu nehmen und wollen sich nur im Schatten des Erfolges der anderen Sonnen.
    Wie sagt Matze immer so schön.
    Es interessiert mich einen SCHEISSDRECK was andere über mich denken.👍🏼
    Dein Statement mir gegenüber ist eine typische Reaktion von jemanden, der sich nicht vorbereitet hat und jetzt Angst bekommt und allen anderen, wie mir, die Schuld gibt und hofft, dass ihm jemand helfen wird.
    Kein einziger Mensch, der sich auf Krisensituationen vorbereitet hat, wird dir helfen.
    Es werden dir nur die Menschen helfen, die sich genau so wenig vorbereitet haben, wie du. Und wie diese Hilfe aussehen wird, kannst du dir selbst ausmalen. Diese Hilfe wird dann so aussehen, dass der eine hofft, dass ihm der andere hilft.
    Naja, die Hoffnung und der Glaube ist ja etwas schönes. Die Frage ist nur, ob dich das satt machen wird.
    Wie schon bereits erwähnt.
    Seit 2008 ist das Finanzsystem an seinem Ende angekommen und seit dem hattest du nun 12 Jahre Zeit dein Geld für krisenvorsorge (Preppern) anzulegen.
    Wenn du es lieber für Handys, Laptops, neue Schuhe, neue Kleidung, Autos, Urlaube und sonstige Konsumgüter ausgegeben hast, so ist dies allein deine Sache.
    Dann brauchst du aber auch nicht herum heulen und andere Menschen angreifen, die mit offenen Augen durchs Leben gehen und sich eben gut vorbereitet haben.

    1

    Stef An
    vor 4 Stunden
    Es wird keinen zweiten lock down geben

    Die Hinterfragerin
    vor 4 Stunden
    @Stef An
    Bist du Hellseher, oder woher hast du diese Information?

    Die Hinterfragerin
    vor 4 Stunden
    @Frank Herrmann
    Ich brauche keine schönere Welt, denn ich lebe in einer schönen Welt 😃

    Die Hinterfragerin
    Markierte Antwort
    Die Hinterfragerin
    vor 4 Stunden
    @Frank Herrmann
    Na dann erkläre mir mal was ein ECHTES Leben ist?
    Da bin ich mal gespannt.
    Ich bin ganz Ohr👂🏼

    Frank Herrmann
    vor 2 Stunden (bearbeitet)
    Ah ja, gleich Zensur bei meiner Antwort. Erst mich fragen, dann spamen, oder wie? Ihr seid auch noch feiges Pack oder sollte ich Ratten sagen?

    @Die Hinterfragerin: Der beste Sklave ist der, der nicht weiß, daß Er Einer ist. Eine echte Sklavin die als Zeichen der Leibeigenschaft ein Armband trug (wenn mich richtig erinner, vielleicht auch ne Kette, Ring, spielt aber nicht die Rolle), wurde dazu befragt und ihrem Sklaventum, bekomme ich leider nicht mehr besser zusammen… und sagte, das ihr Herr gut für Sie sorge, wollte irgendwie keine Freiheit und für Sie war das Band oder Ring positiv besetzt.

    Wer von klein auf es nicht besser kennt, so wie unsereins, keinen Vergleich hat….

    SIE machen uns absichtlich krank, Gesundheit/HEILUNG nicht erwünscht. Impfungen machen krank, Chemtrails machen krank.

    Meine Mutter hatte früher Darmkrebs, nun wurde Leukämie festgestellt, zudem die Lunge teilweise kaputt, die direkte Nachbarin in JUNGEN Jahren an Krebs verstorben, Alzheimer, Hirnschäden in jüngeren Jahren soll stark zunehmen, Nun Impfungen zu Corona (was ein Hoax ist), die DNA/RNA verändernd, Nanobots sollen drin sein oder bald folgen, die im Körper andocken, vielleicht kommen Hirnchips, aber was Sie heute bereits und in naher Zukunft können, glaubst Du das es dann noch Menschlichkeit gibt und mehr/weniger eigenen Willen? Wie und was wird dann künftig gezielt gezüchtet? Gebär-Mütter braucht es nicht mehr, Spermien vermutlich auch nicht, KI (Künstliche Intelligenz) und Roboter, selbst sich replizierend und weiterentwickelnd, lernfähig…. und selbst die Restmenschheit, vollkontrolliert in wenigen riesigen Megacitys, wenn in ihrem Wahn nicht noch mehr zerstört hätten…. dann brauchen auch den größeren Teil des Restes nicht mehr, Mensch-Maschinen, oder nur noch Maschinen irgendwann, Vielleicht noch ein paar Menschen oder sowas Ähnliches, wo züchten, damit Ihnen nicht zu langweilig wird und was zum spielen haben oder für ihren Zoo.

    Ein Ray Kurzweil kündigte Nanobots in unserm Blut und Körper an, die miteinander kommunizieren und Daten senden.. ich meine,… für das Jahr 2045, vermutlich wohl eher früher, zumindest möglich, da ja schon heute Nanochips ausgebracht werden und bei Manchen frage mich eh, ob nicht schon so gesteuert sind, ohne es zu merken und sachlich nicht mehr zugänglich, ob noch selber denken können.

    Ich hatte ja was verlinkt. Sagt Dir MORGELLONS etwas? Anscheinend nicht? Ich weiß nicht, wie ich es als Laie bezeichnen soll und es verschiedene Ausprägungen gibt, Halbsynthetische Lebensform? Vollsynthetische? Das wir von innen mehr/weniger plastinieren, da Plastik, bei Menschen fest ihren Körpern verankert?

    Das findest du gut?

    Antworten bleibst schuldig, nur Gegenfragen. Warum?

    Also ich möchte lieber friedlich und schmerzlos vorher ableben und dieses Elend nicht mehr mitbekommen. Impfungen werde auch verweigern wie und solange es geht, atmen aber muß man und über die Haut dringt es auch ein. Sogar Deine. Wirst es nicht glauben.

    Wir könnten autark sein, betreff Energie um Motoren zu betreiben, bei KFZ. Frei von Erdöl, Wind, Sonne, Kohle Atomkraft, Gas…

    UND zum heizen, Haushaltsstrom

    WER VERHINDERT ES?

    Stichwort FREIE ENERGIE, Magnetmotoren, Generatoren, Wassermotoren.

    Und so ist es auch im Bereich Gesundheit. Ich würde wetten, Krebs ist/wäre schon lange heilbar, ABER MAN WILL ES NICHT heilen. Gesund alt werden scheint bei Dir also keine höhere Priorität zu haben?

    Uschi von der Leiters Vater, dieser EU- Verbrecher, in guter Tradition seit Generationen…. ist an Alsheimer verstorben, Da hat es mal den Richtigen erwischt, Steve Jobs an Krebs gestorben…. Also Sie selbst tragen dazu bei. Arbeiten für Solche, sind Teil davon, was sogar IHNEN selbst auf die Füsse fallen kann.

    Nur leider gibts andere Vögel, die viel zu alt werden.

    Ihre eigene Destruktivität und Gotteswahn….. Die sich selbst für Götter halten, im schlechtesten Sinn handeln…..

    Barren und Münzen
    vor 1 Stunde (bearbeitet)
    @Die Hinterfragerin Jaja, mach du nur, wirst sehen, was du davon hat 😀

    Die Hinterfragerin
    vor 42 Minuten
    @Barren und Münzen
    Ich brauche nichts sehen, denn ich weiß dass es mir gut gehen wird, dort wo ich sein werde 😁
    Oder glaubst du im ernst, dass du hier noch einen Politiker antreffen wirst, wenn es hier im Land losgeht.
    Die sind Wochen zuvor schon in ihren Häusern und Bunkern auf ihrer Insel.
    In diese Richtung kann man von Politiker etwas lernen und gut planen 😁

  14. MFG-Hamburg schreibt:

    Gnadenlose Corona-Diktatur: Merkel-Regime will Maskenverweigerer in den Knast stecken
    (jo…heil merkel und ihren vorgesetzten 🙋‍♂️ ich hoffe die arme sind der richtigen stellung)

    Das neue Untertanen-Modell, die höchstwahrscheinlich völlig unnütze „Alltagsmaske“, muss nun mit aller Macht durchgedrückt werden, schließlich zeigt sie, wer hier im Land mit krummen Rücken herumläuft, oder wer den Gehorsam verweigert. Wer keine Maske trägt, könnte demnächst hinter Gittern landen.

    von Max Erdinger

    Das Verkehrsunternehmen Flixbus zum Beispiel hat jetzt seine Fahrer angewiesen, bei renitenten „Maskenverweigerern“ die Polizei zu rufen. Gegenüber Watson bestätigt ein Sprecher von Flixmobility, zu dem neben Flixbus auch der Bahn-Konkurrent Flixtrain gehört, das Einhalten der Maskenpflicht streng zu kontrollieren und zur Not auch die Polizei hinzuzuziehen. „Sollte es zu einer Situation kommen, in der Busfahrer der Meinung sind, einen Fahrgast von der Beförderung ausschließen zu müssen, sind sie angehalten, die Polizei zu rufen, wenn der Reisende nicht kooperiert“, so der Sprecher.

    Auch die Deutsche Bahn will strenger gegen Maskenverweigerer vorgehen – zur Not auch mithilfe der Bundespolizei. Dafür zeigt Karl-Peter Naumann vom Fahrgastverband Pro Bahn Verständnis. Gegenüber dem Nachrichtenportal Watson sagt er: „Das Problem sind die Maskenverweigerer, insbesondere, wenn diese aggressiv werden. Das Bahnpersonal hat mit aggressiven Verweigerern in der Vergangenheit sehr schlechte Erfahrungen gemacht. Beide Eisenbahngewerkschaften können solche Aggressivitäten aus Umfragen belegen.“

    Vor dem Hintergrund des aggressiven Verhaltens, das viele Mitarbeiter der Bahn bereits erlebt oder beobachtet haben, findet es Naumann nachvollziehbar, wenn das Personal Eskalationen mit Fahrgästen meidet: „Dass die Bahn-Mitarbeiter gegenüber aggressiven Maskenverweigerern zurückhaltend sind, ist verständlich: Schließlich kommt es immer wieder, auch vor Corona schon, zu körperlicher Gewalt gegen Bahn-Personal.“

    Polizei muss einschreiten
    Hilfe ist wohl nur durch die Polizei möglich, meint Naumann. Auch ein Sprecher der Deutschen Bahn bestätigt gegenüber Watson: „Die bestehenden Verordnungen der Bundesländer erlauben im Fall renitenter Maskenverweigerer einen Ausschluss von der Beförderung. Dies setzen wir gemeinsam mit der für die Gefahrenabwehr bei der Bahn zuständigen Bundespolizei konsequent um.“

    Natürlich müssen sich Bahn-Mitarbeiter vor aggressiven Fahrgästen, die zum Beispiel schwarz fahren, schützen und hier die Polizei zur Hilfe rufen. Aber man weiß auch, dass sowas schnell aus dem Ruder laufen kann und Fahrgäste, die von anderen Fahrgästen denunziert werden, auch wenn sie ein Attest vorweisen können, dann Opfer staatlicher Gewalt werden können.

    Maskenverweigerer droht der Knast
    Aber all das geschieht jetzt nur, weil die Demo vom vergangenen Samstag in Berlin die Bundesregierung kalt erwischt hat und jetzt versucht werden muss, diesen neuen politischen Widerstand im Keim zu ersticken. Viel wichtiger wäre es, dass die da oben mal endlich beweisen, dass diese Atemschutzmasken wirklich helfen.

    Hier ein kleiner Hinweis: Es gibt in Deutschland Landkreise, in denen kaum einer diese Alltagsmasken vorschriftsmäßig trägt und sich trotzdem seit vier Wochen KEINER neu infiziert hat. Aber anstatt das zu erklären, werden die „Maskenverweigerer“ wohl bald hinter schwedische Gardinen gesteckt. Mal sehen, ob diese dann schützen.

  15. MFG-Hamburg schreibt:

    EU kippt Regelung zum Schutz vor Gentechnik für Covid-Impfstoff

    Das EU-Parlament hat der neuen Regelung am 10. Juli zugestimmt, der Rat (Ministerrat) am 14. Juli. Die neue Richtlinie tritt am 17. Juli in Kraft

  16. MFG-Hamburg schreibt:

    https://www.bitchute.com/video/BjSDmUJl632y/

    Frau Bundesrätin Sommaruga spricht nun schon in Englisch mit uns! Ach nein, mit England, Bill Gates oder Gavi oder wem bitteschön??? Sind 4 Landessprachen nicht genug? Oder sollen wir es vielleicht nicht verstehen?

    „Doch doch, wir haben es auch verstanden, dass Sie liebe Frau Bundesrätin Sommaruga zusagen Millionen unserer Steuergelder (oder ist es Ihr eigenes Geld? 🤔) auszugeben für einen Impfstoff, den wir gar nicht wollen! Die Kommentare sind selbstsprechend!

    Ach ja und das Video haben wir für euch übersetzt, damit auch alle verstehen was UNSERE Bundesrätin alles erzählt! Hört selber!

  17. MFG-Hamburg schreibt:

    Live – BA(ck)G STUDIO – aktuelle Lag in der Schweiz – 6.8.2020

  18. MFG-Hamburg schreibt:

    13 Frauen brechen das Schweigen – 14. Corona-Mahnwache Bern Bundesplatz
    ———————————————————————————————————-

    Der Film handelt von mutigen Frauen mit Medienkometenz, die ihr Schweigen zum Corona-Wahnsinn gebrochen haben.. Der Videoapotheker arbeitet an Qbricks Ludovico-Therapie: Krönung der Versöhnung. Das frieden wir miteinander hin.

    Bitte unterstütze meine jounalistische Arbeit: IBAN: CH91 0900 0000 3125 3958 9 Konto: 31-253958-9

    „Es ist leichter die Menschen zu täuschen, als sie zu überzeugen, dass sie getäuscht worden sind.”
    Mark Twain

    Neben den 13 Theilnehmerinnen der 14. Corona-Mahnwache vom 25. Juli 2020 und dem aktivistischen Engagement von Dr. Strangelove sind auch meine Interviews mit dem Historiker Dr. Daniele Ganser im Sternensaal Bümpliz, 22. 8. 2019 und mit Nationalrat Pirmin Schwander im Bundeshaus, 26. 9. 2019 enthalten.

    Bundesplatz mit Regula von der Notfall-aufnahme im Spital Thun über Corona
    Youtube: Die 5. Gewalt, 11. 7. 202

    Event 201: Corona-Pandemie vom Reissbrett – was bisher übersehen wurde
    Youtube: ExpressZeitung, 21. 6. 2020

  19. MFG-Hamburg schreibt:

    (SAMMELKLAGE) 31.07.2020
    Rechtsanwalt klagt bei Verfassungsgericht wegen Maskenzwang – Teaser!

    kontakt zum rechtsanwalt: https://www.beneder.net/

  20. MFG-Hamburg schreibt:

    heute schon gelacht??? 😂😂😂

    DONNERSTAG, 06. AUGUST 2020
    „Der stellvertretende Vorsitzende der Unionsfraktion, Arnold Vaatz, hat die Bundesrepublik mit der DDR und die Berliner Polizei mit der Volkspolizei der SED-Diktatur verglichen“
    ————————————————————————————————————————————

    https://www.n-tv.de/politik/Unionsvize-vergleicht-Deutschland-mit-DDR-article21956387.html

    „Los ging es mit Maskenpflicht“
    Unionsvize vergleicht Deutschland mit DDR

    Es ist eine Wortwahl, wie man sie eigentlich nur aus Reihen der AfD kennt – und sie kommt ausgerechnet vom Vize der Unionsfraktion. Arnold Vaatz vergleicht in einem Gastbeitrag die Bundesrepublik mit der DDR, ja sogar einen Vergleich mit der Nazi-Diktatur stellt er an.

    Der stellvertretende Vorsitzende der Unionsfraktion, Arnold Vaatz, hat die Bundesrepublik mit der DDR und die Berliner Polizei mit der Volkspolizei der SED-Diktatur verglichen. In einem Gastbeitrag für das rechte Meinungsmagazin „Tichys Einblick“ schreibt Vaatz unter Verweis auf die „Black Lives Matter“-Proteste: „Die Kernfrage ist, warum bei gleicher Gefahrenlage die BLM-Demonstration gegen Rassismus allgemein gelobt und toleriert und die Demonstration vom 1. August allgemein verflucht wurde.“

    Am 1. August hatten rund 20.000 Menschen an einer Demonstration gegen die Corona-Beschränkungen demonstriert. Eine Kundgebung am Brandenburger Tor wurde von der Polizei aufgelöst, weil die Hygieneregeln nicht eingehalten worden waren.

    Vaatz bezeichnet den von ihm beschriebenen „Wertungsunterschied“ als Fortsetzung eines Glaubwürdigkeitsverfalls. „Los ging es mit Einführung der Maskenpflicht, nachdem es lange hieß, Masken nützten nichts – solange es keine zu kaufen gab. In der DDR streute die Partei, Bananen seien gar nicht so gesund“, schreibt Vaatz und unterstellt der Bundesregierung, Strategien der DDR-Führung zu übernehmen. Er schreibt: „Von Monat zu Monat lernt man mehr von der DDR. Die dreiste Kleinrechnung der Teilnehmerzahlen der Demo vom 1. August durch die Berliner Polizei entspricht in etwa dem Geschwätz von der ‚Zusammenrottung einiger weniger Rowdys‘, mit der die DDR-Medien anfangs die Demonstrationen im Herbst 1989 kleinrechneten.“

    „Bei Nazis war es Sippenhaft, heute ist es Kollektivhaft“
    In der DDR habe man versucht, die Menschen vom Demonstrieren abzuhalten, indem man ihnen unterstellte, im Auftrag der CIA oder des westdeutschen Bundesnachrichtendienstes zu handeln. Auch heute, so Vaatz, würde diese Strategie angewendet. „Der heutige Versuch, die Straßen leerzubekommen, besteht in der Warnung: ‚Pass auf, mit wem du demonstrierst.'“ Demonstranten würden damit bedroht, „als Nazi diffamiert und damit gesellschaftlich ruiniert zu werden“. Und auch einen Vergleich mit der Nazi-Diktatur lässt Vaatz nicht aus. Er schreibt: „Bei Nazis war es Sippenhaft, im Deutschland von heute ist es Kollektivhaft.“

    Am vergangenen Samstag hatten Tausende Menschen in Berlin gegen die Corona-Maßnahmen der Bundesregierung protestiert. Auf Transparenten wurde dabei behauptet, die Pandemie sei nur ein Vorwand, um ein diktatorisches Regime zu errichten. Viele Demonstranten stritten ab, dass das Virus überhaupt gefährlich sei. Anhänger von Verschwörungsideologien gingen ebenso auf die Straße wie Menschen, die eindeutige Symbole der rechtsextremen Szene – etwa die Kaiserreichsflagge – zeigten. Die Polizei schätzte die Teilnehmerzahl auf 17.000 bis 20.000 Menschen. Die Veranstalter selbst sprachen von mehr als einer Million Teilnehmer. Im Netz kursiert sogar das Gerücht, es seien bis zu fünf Millionen Menschen gekommen.

    Die Unionsfraktion reagierte zurückhaltend. Ein Sprecher distanzierte sich gegenüber dem „Focus“ von Vaatz‘ Artikel mit den Worten: „Herr Vaatz hat in dem Meinungsbeitrag seine persönliche Auffassung als MdB geäußert – diese spiegelt nicht die Haltung der Unionsfraktion im Deutschen Bundestag wider.“

    Beim Koalitionspartner SPD sorgten Vaatz‘ Äußerungen für Entsetzen: „Wenn der Hass auf die rot-rot-grüne Landesregierung ins Wahnhafte abdriftet, dann entfaltet das eine Wirkung wie nach dem dritten Akvavit bei der Familienfeier: Bei Onkel Arnold wird die Zunge locker. Gruselig“, schrieb Juso-Chef Kevin Kühnert auf Twitter. Der SPD-Abgeordnete Timon Gremmels forderte Unionsfraktionschef Ralph Brinkhaus dazu auf, zu dem Artikel Stellung zu nehmen. Er schrieb: „Wenn der stellvertretende CDU/CSU-Vorsitzende Vaatz bei ‚Tichys Einblick‘ bezüglich der Corona-Demo vom vergangenen Wochen Vergleiche mit dem NS und dem DDR-Regime zieht, erwarte ich von Ralph Brinkhaus eine klare Distanzierung!“

  21. MFG-Hamburg schreibt:

    Irreführung und „Fake News“: Der Umgang mit den Corona-Kritikern

  22. MFG-Hamburg schreibt:

    wie ich angekündigt hatte, wird die demo -teilnehmeranzahl entsprechend groß, beginnen die leute aus den behörden widerstand zu leisten, der polizist bekundete exakt das, aufgrund der masse von ca. 1.3 millonen sich bestärkt sah, endlich stellung zu beziehen.

    Der erste Polizist sagt öffentlich seine Meinung in Augsburg auf dem Fest für Frieden und Freiheit

  23. MFG-Hamburg schreibt:

    Dominosteine fallen – Kriminalhauptkommissar Im Dienst!

  24. Jochen schreibt:

    Maßnahmen gegen den Corona-Wahnsinn.
    Unterstützt die Arbeit des Coronaausschusses!

  25. MFG-Hamburg schreibt:

    Systemwechsel? Trump setzt Lohnsteuer aus („Epoch Times“)
    ————————————————————————————
    „denn das bedeutet einen radikalen Systemwechsel, der die ganze Welt betrifft.“(„Epoch Times“)

    nöö…aber im diesem video wird eine möglichkeit angesprochen, die dem tatsächlich gerecht wird.
    wie ich voraus gesagt hatte, befinden sich alle beteiligten demo-sprecher in einem prozess, der letztendlich aus dem personen-system =sklavensystem herausführen können…exakt das wird in diesem video angesprochen

    „250.000 Wahlberechtigte können innerhalb von 18 Monaten eine Volksabstimmung beantragen zum Grundgesetz sowie zu allen Gesetzen und Verordnungen des Bundes. Nach Erreichen der notwendigen Mindestzahl von Unterschriften hat eine Volksabstimmung des deutschen Volkes binnen 6 Monaten stattzufinden.
    Das Ergebnis der Volksabstimmung ist für den Deutschen Bundestag und die Bundesregierung verpflichtend und innerhalb von 6 Monaten ohne Änderungen umzusetzen.
    Sollte das nationale Recht dabei in Konflikt mit europäischem Recht geraten, ist das nationale Recht maßgebend.“

    • MFG-Hamburg schreibt:

      zusatz: ich bin sicher, auch hier werden die nörgler wieder die texte inhaltlich nicht verstehen: für tiefschläfer:

      „Volksabstimmung beantragen zum Grundgesetz sowie –

      — entscheidend –: „zu allen Gesetzen und Verordnungen des Bundes“

      damit läßt sich das parteien system auflösen. die Kernkompetenzen werden auf die einzelnen bundesländer übertragen mit direkter volksabstimmung der jeweiligen bundesländer……ende der dikatur, der parteiensysteme.

    • MFG-Hamburg schreibt:

      muß den kommentar nochmals erweitern:

      nun werden einige kritiker einwerfen das GG gelte garnicht mehr, zudem sei die regierung eine NGO. dazu sei gesagt und ich habe das schon öfter gesagt, es gilt NICHT was auf dem blatt papier steht, sondern der konsens, der sich in den köpfen der gesellschaft manifestiert hat, da die regierung ÖFFENTLICH diesem konsens zustimmt, ergibt sich daraus eine exekutive kraft zum handeln. das bedeutet, die regierung kann NICHT massiv öffentlich dem widersprechen, ohne das diese zu sofort gestürzt wird.

  26. Solist schreibt:

    Dimash Kudaibergen – Qairan Elim

    Q-Anon ist so amazing
    https://vids.theoven.lol/video/1424/q-anon-ist-so-amazing?channelName=aniassy
    04-05/2020

    Die Corona-Operation Teil 2: Erpressung zur Agenda 2030

    Everyone has Aids

  27. MFG-Hamburg schreibt:

    das sollten sich die schweizer einmal komplett anhören um zu begreifen das die erlassenen corona-gesetze ungültig sind. heißt, es ist gegenklage einzureichen und zwar in masse

    Folge 33 Corona Schweiz und Krieg gegen Menschen

  28. Solist schreibt:

    DESinfo/Propaganda
    SPANNEND! Trump will sich vor den Wahlen mit Putin treffen!

    Übrigens zensierte auch watergate Kommentare auf ihrem Blog.

  29. Solist schreibt:

    Q anon VS Q uerdenken – die Hohepriester und der Freie Wille [2k 1440p]

    Bienchen Honeymoon
    vor 3 Tagen
    Brilliantes Video, vielen Dank! Vor längerer Zeit wollte ich mal die Thurner auf einen Kaffee besuchen, die wohnt ca 14 km von mir weg. Ich wollte sie fragen, ob sie wirklich meint, was sie da sagt. Damals war Q noch kein Thema, ich bin dann aber rasch draufgekommen, wen sie da vertritt. Auch ohne nähere Kenntnisse der Symbolik und der Numerologie, wenn man nur ein bisschen vom Hirn nutzt, welches man zum Denken mitbekommen hat, erschliesst sich einem alles Nötige, wen und was sie vertritt. Ein jeder aber, welcher der Sache auf den Grund gehen will, sollte sich dringend mit Numerologie und Symbolik befassen, alleine dadurch kann man sofort Fake Truther erkennen. Deine Aufklärungsvideos sind äusserst wichtig, ein Augenöffner für jene, welche an Q und Trump zu zweifeln beginnen, weil sie raffen, das nix von dem jemals eingetreten ist, was sie da labern. Der neuerste Schmäh: Trump muss eine Impfung anbieten, so zum Schein, wegen seinen Feinden. Diese Impfung wird dann eine gute sein, ohne das Gift. Weil es gibt ja auch gute Menschen in der Pharmaindustrie! 🙂

  30. Jochen schreibt:

    Früher war es so, da trugen nur die Bösen eine Maske um z.B. eine Bank auszurauben. Heute kann man die Bösen von den Guten kaum mehr unterscheiden, da so gut wie alle Masken tragen (müssen). Oder sind heute nur noch jene die Bösen, welche es kategorisch ablehnen eine Maske zu tragen?

    https://magnuswolfgoeller.de/2020/05/von-den-rotzmaskenmoerdern/

    Unbedingt auch die Kommentare durchlesen, denn darin kommt das wahre Böse zum Vorschein, wenn auch hinter einer Maske.

  31. MFG-Hamburg schreibt:

    neuer impfstoff der russen veröffentlicht

  32. MFG-Hamburg schreibt:

    die bezahlten beitragsschreiber outen sich mal wieder selbst zum x-ten mal 😂😂😂

    https://terraherz.wpcomstaging.com/2020/08/18/so-langsam-wird-es-zeit-liebe-leute-wacht-auf/comment-page-1/#comment-130585

    wie dämlich muß man sein um gegen die demos zu hetzen….die deutschen sind für a’la französische revolutionen bekannt 😂 das einzige wovon ausgegangen werden kann, den elitären köpfen ist natürlich klar, es wird zum massenwiderstand kommen, sodann im gleichen augenblick eine totalen lockdown auszulösen, um den ganzen laden gegen die wand zu fahren…..ABER…..wenn halb europa nicht länger mitspielt, wenn die demos eine qualität aufzeigen, die den eliten das gesamtkonzept zerstören, wird ne vollbremsung eingeleitet, damit die kontrolle nicht flöten geht……und deshalb das gedröhne. wie übel doch die demos sind, ja immer nur alles gesteuerte und nur hirnlose am ruder….oder doch NICHT?

    SIEHE:
    ————-
    neue N-TV meldung:
    „Ein Virologe sieht Anzeichen für eine Abschwächung von Sars-CoV-2 und nährt Hoffnungen auf einen glimpflichen weiteren Verlauf der Pandemie.“

    https://www.n-tv.de/wissen/Covid-19-bald-nur-noch-Erkaeltung–article21981433.html
    ————
    wat ein zufall,
    springermedien am zurück rudern, WARUM NUR 😂

  33. MFG-Hamburg schreibt:

    entnommener hinweis: Antimarionette
    21. August 2020 um 22:04 Uhr
    AAACHTUNG – GANZ WICHTIG – bitte UNBEDINGT alle KOMMENTARE von Kim lesen!!! Wird ja immer doller…
    ——————————————
    dazu angemerkt hatte:
    oh danke, obwohl der betrug ohnehin klar ist. virologen bezeichnen es bloß anders, sie gehen ohnehin davon aus, daß ca. 60 millionen unterschiedliche typen, sogenannter viren sich im körper befinden. wobei es ja bloß bausteine sind, die als virenrückstände, letztendlich ermittelt gelten…naja….und die sache wird noch deutlicher, wenn systembiologen ins spiel kommen, die das glaubenssystem der virologen usw. als witz bezeichnen 🤣😂🤣

    ein herausragender beitrag von RT—ANSEHEN

    —————————————————————————————————————————–

    BOMBSHELL: WHO-Coronavirus-PCR-Test-Primer-Sequenz wird in der gesamten menschlichen DNA gefunden /Von Rixon Stewart am 21. August 2020

    Steve Kelly – Ein Stück des Gedächtnisses 6. April 2020

    https://i0.wp.com/www.thetruthseeker.co.uk/wordpress/wp-content/uploads/2020/08/who-primer.png?zoom=2

    Das war so wichtig, dass ich es sofort herausholen wollte. Meine Recherchen in der NCBI-Datenbank für Nukleotidsequenzen haben zu einer verblüffenden Entdeckung geführt. Eine der WHO-Primersequenzen im PCR-Test für SARS-CoV-2 findet sich in der gesamten menschlichen DNA! Die Sequenz „CTCCCTTTTGTTTGTGTTTTTGT“ ist eine 18-stellige Primersequenz, die im Dokument des WHO-PCR-Testprotokolls für Coronaviren zu finden ist. Die Primersequenzen werden durch das PCR-Verfahren amplifiziert, um nachgewiesen und als „positives“ Testergebnis bezeichnet zu werden. Zufälligerweise findet sich genau diese 18-Zeichen-Sequenz wörtlich auch auf dem Homo sapiens-Chromosom 8! Soweit ich das beurteilen kann, bedeutet dies, dass die WHO-Testkits bei allen Menschen ein positives Ergebnis finden sollten. Kann das jemand anders erklären? Ich kann die Bedeutung dieses Ergebnisses wirklich nicht genug betonen. Zumindest sollte es einen nennenswerten Einfluss auf die Testergebnisse haben.
    https://i2.wp.com/www.thetruthseeker.co.uk/wordpress/wp-content/uploads/2020/08/who-primer-2-768×293.png?zoom=2

    Homo sapiens-Chromosom 8, GRCh38.p12 Primäre Versammlung
    Sequenz-ID: NC_00000008.11 Länge: 145138636
    Bereich 1: 63648346 bis 63648363 ist „CTCCCTTTGTTTGTGTTTTGT“.

    Update: Nach einiger Anstrengung habe ich endlich einen Weg gefunden, um (über meine Screenshots hinaus) den Beweis zu erbringen, dass das menschliche Chromosom 8 genau dieselbe 18-Zeichen-Sequenz aufweist. Bitte versuchen Sie den untenstehenden Link. Die Sequenz wird unten auf der Seite angezeigt.

    https://www.ncbi.nlm.nih.gov/nucleotide/NC_000008.11?report=genbank&log$=nuclalign&from=63648346&to=63648363

    Bombensicherer Nachweis, dass COVID-RNA-Basenpaare mit der menschlichen DNA von Chromosom 8 identisch sind
    YumNaturals Emporium – 20. August 2020

    https://www.ncbi.nlm.nih.gov/nucleotide/NC_000008.11?report=genbank&log$=nuclalign&from=63648346&to=63648363

  34. MFG-Hamburg schreibt:

    ACHTUNG LEBENSWICHTIGE INFO, SOFORT ANHÖREN UND WEITERVERTEILEN
    ———————————————————————————————————————–

    es handelt sich nicht einfach um infos. sie ist über aktuelle informationen gestolpert und hat diese analytisch betrachtet und mit der gegenwärtigen entwicklung, zu einem katastrophalen schluß gelangt, in der ich ihr absolut recht geben muß. der 29.08.2020 ist der letzte tag um das ruder herum zu reißen, danach wird ein lockdown eintreten, der niemals mehr enden wird. die WHO hat gerade eine meldung heraus gegeben, in der klip und klar angekündigt wurde, es wird niemals mehr ein zurück geben.

    https://www.merkur.de/welt/coronavirus-who-masken-verbote-abstand-pandemie-ende-prognose-impfung-behandlung-rki-zr-90028550.html

    • MFG-Hamburg schreibt:

      zusatz: „ACHTUNG! Anschober will Gesetz ändern und uns unter Hausarrest stellen“

      „Ohne großes Aufsehen und Debatte soll das Covid-Gesetz geändert werden, damit wir alle legal unter Hausarrest gestellt werden können! Bitte teilen Sie das Video in ihren Netzwerken, damit das Thema öffentlich wahrgenommen wird! Wir haben nur noch 4 Tage Zeit!“

      also bis zum 28.08.2020, was ein zufall, paßt exakt zum geplanten lockdown des 30.08.2020

  35. Pingback: Die Masken Vollidioten in der NWO CORONA-DIKTATUR – Wake News Radio/TV | Mywakenews's Blog

  36. Pingback: Unser Leben in der NWO-CORONA Blase – Team Talk Wake News Radio/TV | Mywakenews's Blog

  37. Pingback: Ist es das Beste alle Re-Gier-ungen abzuschaffen? Wake News Radio/TV | Mywakenews's Blog

  38. Pingback: Corrupt Governments in the Hands of Criminal Billionaires – United We Start Roundtable Discussion 20200912 | Mywakenews's Blog

  39. Pingback: Lasst euch nicht von Re-GIER-ungen terrorisieren! – Wake News Radio/TV | Mywakenews's Blog

  40. Pingback: Können wir die Neue Welt Ordnung und unsere Vernichtung noch abwenden? Wake News Radio/TV | Mywakenews's Blog

  41. Pingback: Die 3 Geisseln dieser WELT – Wake News Radio/TV | Mywakenews's Blog

  42. Pingback: Kampf mit dem Drachen – Wa(h)r da was – Talk mit Michael – Wake News Radio/TV | Mywakenews's Blog

  43. Pingback: Wann wacht die Menschheit endlich auf? Wake News Radio/TV | Mywakenews's Blog

  44. Pingback: Who And What Will Take Down The US And The World First? United We Start Roundtable Discussion 20201010 | Mywakenews's Blog

  45. Pingback: Warum glauben und vertrauen die Menschen den Re-GIER-ungen? Wake News Radio/TV | Mywakenews's Blog

  46. Pingback: Die CORONA Massen-Halluzination – Team Talk 20.10.2020 Wake News Radio/TV | Mywakenews's Blog

Kommentar verfassen

Trage deine Daten unten ein oder klicke ein Icon um dich einzuloggen:

WordPress.com-Logo

Du kommentierst mit Deinem WordPress.com-Konto. Abmelden /  Ändern )

Google Foto

Du kommentierst mit Deinem Google-Konto. Abmelden /  Ändern )

Twitter-Bild

Du kommentierst mit Deinem Twitter-Konto. Abmelden /  Ändern )

Facebook-Foto

Du kommentierst mit Deinem Facebook-Konto. Abmelden /  Ändern )

Verbinde mit %s